View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3367_low_28 (Length: 236)

Name: NF3367_low_28
Description: NF3367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3367_low_28
NF3367_low_28
[»] chr6 (1 HSPs)
chr6 (74-221)||(34431955-34432102)


Alignment Details
Target: chr6 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 74 - 221
Target Start/End: Complemental strand, 34432102 - 34431955
Alignment:
74 cgtcgccgccgtaatggtaacctgcttcttctcttccgatcatttctcaatgcgcgtttcgattttcaactctatcgtttgaatcactaacttcaatttc 173  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
34432102 cgtcgccgccgtaatggtaacctgcttcttctcttccgatcatttctcaatgcgcatttcgattttcaactctatcgtttgaatcactaacttcaatttc 34432003  T
174 ttcacactttagttttcttcaatttcttcattttcaaccgattaaatc 221  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
34432002 ttcacactttagttttcttcaatttcttcattttcaaccgattaaatc 34431955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University