View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3367_low_5 (Length: 440)
Name: NF3367_low_5
Description: NF3367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3367_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 4e-91; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 4e-91
Query Start/End: Original strand, 234 - 418
Target Start/End: Original strand, 30567348 - 30567530
Alignment:
| Q |
234 |
ttgttgaataaaatggtgaatctctctctgaaagagaaaagggagagacagagagaaagtttttaggtttataacggtcgaatttgtgaggtgtttatag |
333 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30567348 |
ttgttgaataaaatggtgaatctc--tctgaaagagaaaagggagagacagagagaaagtttttaggtttataacggtcgaatttgtgaggggtttatag |
30567445 |
T |
|
| Q |
334 |
agaaagtgaaggagctgattttggtaagttttaataatttaatattatttgctgaatatgagagatattccaacggtcaattatc |
418 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30567446 |
agaaagtgaaggagctgattttggtaagttttaataatttaatattatttgctgaatatgagagatattccaacggtcaattatc |
30567530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 18 - 129
Target Start/End: Original strand, 30567140 - 30567251
Alignment:
| Q |
18 |
ttgatgaaaggtttgatatcgcacgaggcgaagcggaagaagggggtgttgatagcgtttctagacggagggaggttattgttgacatcccagccgggag |
117 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30567140 |
ttgatgaaaggtttgatatcgcgcgaggcgaagcggaagaagggggtgttgatagcgtttctagacggagggaggttattgttgacatcccagccgggag |
30567239 |
T |
|
| Q |
118 |
gtttagacctga |
129 |
Q |
| |
|
|||||||||||| |
|
|
| T |
30567240 |
gtttagacctga |
30567251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 177 - 214
Target Start/End: Original strand, 30567298 - 30567334
Alignment:
| Q |
177 |
ctttgataaagaaaagtatataatattaatattaagat |
214 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30567298 |
ctttgataaa-aaaagtatataatattaatattaagat |
30567334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University