View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3367_low_8 (Length: 349)
Name: NF3367_low_8
Description: NF3367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3367_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 9 - 334
Target Start/End: Complemental strand, 55422995 - 55422658
Alignment:
| Q |
9 |
gaagaatataatagaatgaatgaaggttgttgatctttctttctttctttctgaaaaatgaaaatggcgaccctgataaggttaccaacagccacacctg |
108 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
55422995 |
gaagaatagaatagaatgaatgaaggttgttgatctttctttctttctttctgaaaaatgaaaatggcgaccctgatgaggttaccaacagccacacctg |
55422896 |
T |
|
| Q |
109 |
gtagggtggtgacgaggacgagagaggcatttcatgctctttctccttctcct------------cctcattttgttgagttttgcaaaggtggaagaat |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
55422895 |
gtagggtggtgacgaggacgagagaggcatttcatgctctttctccttctccttctccttctcctcctcattttgttgagttttgcaaaggtggaagaag |
55422796 |
T |
|
| Q |
197 |
aggaagaaggattattagagtgggagtgaaatgcaatagcaattcagagagggcggtgaatcttggaccagggacacctgttaggccaacgagtatactt |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55422795 |
aggaagaaggattattagagtgggagtgaaatgcaatagcaattcagagagggcggtgaatcttggaccagggacacctgttaggccaacgagtatactt |
55422696 |
T |
|
| Q |
297 |
gtggttggagccacggggactttgggaaggcagattgt |
334 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
55422695 |
gtagttggagccacggggactttgggaaggcagattgt |
55422658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University