View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3368_high_12 (Length: 227)
Name: NF3368_high_12
Description: NF3368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3368_high_12 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
| [»] scaffold0552 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 7 - 227
Target Start/End: Original strand, 6830236 - 6830456
Alignment:
| Q |
7 |
acaaagacaagtttttgagttgggtagtaggggtcactaaagctaccgaatattttgggccgagtgatctcatttacaggtacttttaaacttaaatatt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6830236 |
acaaagacaagtttttgagttgggtagtaggggtcactaaagctaccgaatattttgggccgagtgatctcatttacaggtacttttaaacttaaatatt |
6830335 |
T |
 |
| Q |
107 |
tgcttgatttcaaatattagtatatgttttgatttgatttaaaccccatggattgcctccgtggtgtaagctttgagaccaggaagtttggtcggcttgt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
6830336 |
tgcttgatttcaaatattagtatatgttttgatttgatttaaaccccatggattgcctccgtggtgtaagctttgagaccaggaagtttggtcggcttct |
6830435 |
T |
 |
| Q |
207 |
atacacgtgtgtccctagcat |
227 |
Q |
| |
|
||||||||| || |||||||| |
|
|
| T |
6830436 |
atacacgtgcgttcctagcat |
6830456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0552 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: scaffold0552
Description:
Target: scaffold0552; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 7 - 227
Target Start/End: Original strand, 9737 - 9957
Alignment:
| Q |
7 |
acaaagacaagtttttgagttgggtagtaggggtcactaaagctaccgaatattttgggccgagtgatctcatttacaggtacttttaaacttaaatatt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9737 |
acaaagacaagtttttgagttgggtagtaggggtcactaaagctaccgaatattttgggccgagtgatctcatttacaggtacttttaaacttaaatatt |
9836 |
T |
 |
| Q |
107 |
tgcttgatttcaaatattagtatatgttttgatttgatttaaaccccatggattgcctccgtggtgtaagctttgagaccaggaagtttggtcggcttgt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
9837 |
tgcttgatttcaaatattagtatatgttttgatttgatttaaaccccatggattggctccgtggtgtaagctttgagaccaggaagtttggtcggcttct |
9936 |
T |
 |
| Q |
207 |
atacacgtgtgtccctagcat |
227 |
Q |
| |
|
||||||||| || |||||||| |
|
|
| T |
9937 |
atacacgtgcgttcctagcat |
9957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University