View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3368_high_5 (Length: 299)
Name: NF3368_high_5
Description: NF3368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3368_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 7 - 283
Target Start/End: Complemental strand, 41424813 - 41424537
Alignment:
| Q |
7 |
ggtaactatttcaaatttatttcattcaaaattatgtaaatttcttgatgacatgattggtgttacctgaatgctatgacttcgataaactctgtgtcta |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41424813 |
ggtaactatttcaaatttatttcattcaaaattatgtaaatttcttgatgacatgattggtgttacctgaatgctatgacttcgataaactctgtgtcta |
41424714 |
T |
 |
| Q |
107 |
tctgcaacatcaaaagaaagtcttcattttaagcaatcgaaacctatcatgcaaccttatgaataagttcaatataaggctttttaatttaatttacatc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41424713 |
tctgcaacatcaaaagaaagtcttcattttaagcaatcgaaacctatcatgcaaccttatgaataagttcaatataaggctttttaatttaatttacatc |
41424614 |
T |
 |
| Q |
207 |
aaaacttaagaatatctcaaagttaaatctagcttaccccagtttcttccttcacttctcttacagctcctgtataa |
283 |
Q |
| |
|
||||||||||| ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41424613 |
aaaacttaagattatctcaaagttaaatcaatcttaccccagtttcttccttcacttctcttacagctcctgtataa |
41424537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University