View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3368_high_6 (Length: 263)
Name: NF3368_high_6
Description: NF3368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3368_high_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 18 - 250
Target Start/End: Complemental strand, 19887722 - 19887490
Alignment:
| Q |
18 |
ggcattacactatgcagttgagaattgtagccgagaagtggtgaaagccctgcttgaactcggtgctgcggatgttaactacccggctggacctgccggg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
19887722 |
ggcattacactatgcagttgagaattgtagccgagaagtggtgaaagccctgcttgaactcggggctgcggatgttaactacccggctggacctgccggg |
19887623 |
T |
|
| Q |
118 |
aaaacttcccttcatgtggctgccgaaatggtgtcgccggagatggtggcagttttgcttgaccaccatgcagatcctacagttagaaccgttgacggtg |
217 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19887622 |
aaaacttcccttcatgtggctgccgagatggtgtcgccggagatggtggcagttttgcttgaccaccatgcagatcccacagttagaaccgttgacggtg |
19887523 |
T |
|
| Q |
218 |
tcacacctttggatatacttagaaccctaacct |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
19887522 |
tcacacctttggatatacttagaaccctaacct |
19887490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 18 - 248
Target Start/End: Original strand, 35319415 - 35319645
Alignment:
| Q |
18 |
ggcattacactatgcagttgagaattgtagccgagaagtggtgaaagccctgcttgaactcggtgctgcggatgttaactacccggctggacctgccggg |
117 |
Q |
| |
|
|||||||| ||||| ||||||||||| || ||||||| ||||||||| | | ||||||||||| || |||||||||| ||||||||| || |||| |
|
|
| T |
35319415 |
ggcattaccttatgccgttgagaattgcagtagagaagttgtgaaagccttattggaactcggtgcagccgatgttaacttcccggctggtccaaccggt |
35319514 |
T |
|
| Q |
118 |
aaaacttcccttcatgtggctgccgaaatggtgtcgccggagatggtggcagttttgcttgaccaccatgcagatcctacagttagaaccgttgacggtg |
217 |
Q |
| |
|
||||| | ||||| | || || || ||||| || ||||| |||||||| |||||||| |||||||| || || || | || ||||| ||||| |||| |
|
|
| T |
35319515 |
aaaaccccgcttcacattgcagcggagatggtctcaccggatatggtggctgttttgctcgaccaccacgctgacccaaatgtgagaacagttgatggtg |
35319614 |
T |
|
| Q |
218 |
tcacacctttggatatacttagaaccctaac |
248 |
Q |
| |
|
| ||||| ||||| || || ||||||||||| |
|
|
| T |
35319615 |
ttacaccattggacattctaagaaccctaac |
35319645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University