View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3369_high_2 (Length: 266)
Name: NF3369_high_2
Description: NF3369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3369_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 249
Target Start/End: Original strand, 43806555 - 43806804
Alignment:
| Q |
1 |
cactggaaactatattttcttccgaaatttgacttgcagaatgacttttatgcttggttagttggcgttttttagtctcaatttggtttgcactacaaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43806555 |
cactggaaactatattttcttccgaaatttgacttgcagaatgacttttatgcttggttagttggcgtgttttagtctcaatttggtttgcactacaaac |
43806654 |
T |
 |
| Q |
101 |
agcttcaatgtcatnnnnnnnttcattgtcactagataaatggacaatttctattgcttccatatctatacctgtttgttatgtatcaccaaagcaaata |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43806655 |
agcttcaatgtcatcccccccttcattgtcactagataaatggacaatttctattgcttccatatctatacctgtttgttatgtatcaccaaagcaaata |
43806754 |
T |
 |
| Q |
201 |
ttaatcataaattcgtttgttatttattaatat-agagtagagagatcaa |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43806755 |
ttaatcataaattcgtttgttatttattaatataagagtagagagatcaa |
43806804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University