View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3371_high_15 (Length: 294)
Name: NF3371_high_15
Description: NF3371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3371_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 1 - 275
Target Start/End: Complemental strand, 2956295 - 2956021
Alignment:
| Q |
1 |
acaaaccaagaaccgcactcaaaggcacccaaatacaactccctagcatactatcggttccaacagatagtatgttccacaaccacttgtaatgggaacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2956295 |
acaaaccaagaaccgcactcaaaggcacccaaatacaactccctagcatactatcggttccaacagatagtatgttccacaaccacttgtaatgggaacc |
2956196 |
T |
 |
| Q |
101 |
cggatggaacgataagctatttcatccaatcaaagaaattgaagcacattgattaatgtttaaaccatttcatcaagatagaagcttttgtaccaaggac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
2956195 |
cggatggaacgataagctatttcatccaatcaaagaaattgaagcacattgattaatgtttaaaccgtttcatctagatagaagcttttgtaccaaggac |
2956096 |
T |
 |
| Q |
201 |
aacaaataacataatcagttaacagccaaatcatcttatcaatgctttaaagccaaatcatttggatgatgagca |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2956095 |
aacaaataacataatcagttaacagccaaatcatcttatcaatgctttaaagccaaatcatttggatgatgagca |
2956021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University