View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3371_high_17 (Length: 279)
Name: NF3371_high_17
Description: NF3371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3371_high_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 19 - 133
Target Start/End: Complemental strand, 4597998 - 4597884
Alignment:
| Q |
19 |
cttcagtgtcaatgaaccagattggaacagtttgtataatgctagatgcaatttagcctctaagaaatctgttaaatagagccatttattttgacatgga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |||| || ||||||||||||||||||||| || ||||| |
|
|
| T |
4597998 |
cttcagtgtcaatgaaccagattggaacagtttgtataatgctatatacaatttagcctctcagaattcagttaaatagagccatttatttggatatgga |
4597899 |
T |
 |
| Q |
119 |
gttaagtttacattt |
133 |
Q |
| |
|
|||||| |||||||| |
|
|
| T |
4597898 |
gttaagcttacattt |
4597884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 190 - 259
Target Start/End: Original strand, 16367192 - 16367261
Alignment:
| Q |
190 |
caaacgtggtgtataaagaaattttcagaaatgtgtaatgtatgaattatgaattcatatcagttccatt |
259 |
Q |
| |
|
|||| ||||| ||||||||||||||| |||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
16367192 |
caaatgtggtatataaagaaattttccaaaatttgtaatgtatgaattatgaaatcatatcagttccatt |
16367261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University