View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3371_high_24 (Length: 239)
Name: NF3371_high_24
Description: NF3371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3371_high_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 6 - 221
Target Start/End: Original strand, 26766276 - 26766491
Alignment:
| Q |
6 |
ccatacatatgctcaaagagactagatcatggagtgttactggtgggatatggatctggagcctattcgcctattaggttgaaggagaagccatattgga |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26766276 |
ccatacatatgctcaaagagactagatcatggagtgttactggtgggatatggatctggagcctattcgcctattaggttgaaggagaagccatattgga |
26766375 |
T |
|
| Q |
106 |
taattaaaaactcatggggtgagacttggggagaaaatggatactataaaatatgcaggggacgaaatatctgcggagtggactctatggtttctactgt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26766376 |
taattaaaaactcatggggtgagacttggggagaaaatggatactataaaatatgcaggggacgaaatatctgcggagtggactctatggtttctactgt |
26766475 |
T |
|
| Q |
206 |
ggctgccgttcatact |
221 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
26766476 |
ggctgccgttcatact |
26766491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 86 - 211
Target Start/End: Complemental strand, 27549201 - 27549076
Alignment:
| Q |
86 |
gaaggagaagccatattggataattaaaaactcatggggtgagacttggggagaaaatggatactataaaatatgcaggggacgaaatatctgcggagtg |
185 |
Q |
| |
|
|||||||||||| |||||||| |||||| ||| ||||| ||||| ||||||||||||||||||||||| || || ||||||||||||||||| |||||| |
|
|
| T |
27549201 |
gaaggagaagccgtattggattgttaaaagctcctggggcgagacgtggggagaaaatggatactataagatttgtaggggacgaaatatctgtggagtg |
27549102 |
T |
|
| Q |
186 |
gactctatggtttctactgtggctgc |
211 |
Q |
| |
|
||||| |||||||||||||||||||| |
|
|
| T |
27549101 |
gactcaatggtttctactgtggctgc |
27549076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 86 - 211
Target Start/End: Original strand, 27945520 - 27945645
Alignment:
| Q |
86 |
gaaggagaagccatattggataattaaaaactcatggggtgagacttggggagaaaatggatactataaaatatgcaggggacgaaatatctgcggagtg |
185 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||| |||||||| || |||||||| || || |||||||||||||||||||| |||||| |
|
|
| T |
27945520 |
gaaggagaagccgtattggatcgttaaaaactcgtggggtgagacctggggagagaacggatactacaagatttgcaggggacgaaatatctgtggagtg |
27945619 |
T |
|
| Q |
186 |
gactctatggtttctactgtggctgc |
211 |
Q |
| |
|
||||| |||||||||||||||||||| |
|
|
| T |
27945620 |
gactcaatggtttctactgtggctgc |
27945645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 86 - 211
Target Start/End: Original strand, 27437028 - 27437153
Alignment:
| Q |
86 |
gaaggagaagccatattggataattaaaaactcatggggtgagacttggggagaaaatggatactataaaatatgcaggggacgaaatatctgcggagtg |
185 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||| |||||||| || |||||||| || || ||||| |||||||||||||| |||||| |
|
|
| T |
27437028 |
gaaggagaagccgtattggatcgttaaaaactcgtggggtgagacctggggagagaacggatactacaagatttgcagaggacgaaatatctgtggagtg |
27437127 |
T |
|
| Q |
186 |
gactctatggtttctactgtggctgc |
211 |
Q |
| |
|
||||| |||||||||||||||||||| |
|
|
| T |
27437128 |
gactcaatggtttctactgtggctgc |
27437153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University