View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3371_high_26 (Length: 238)
Name: NF3371_high_26
Description: NF3371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3371_high_26 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 3 - 238
Target Start/End: Complemental strand, 49511332 - 49511097
Alignment:
| Q |
3 |
tatattcactgtcaaacaagataaccccattggagcaactctaattggaagagcttatgttccagttgaacaagtcataaagggcaacatagtgaataca |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49511332 |
tatattcactgtcaaacaagataaccccattggagcaactctaattggaagagcttatgttccagttgaacaagtcataaagggcaacatagtgaataca |
49511233 |
T |
|
| Q |
103 |
tgggttaatatattagatgtagatcatcgtccaatacaaggcggttccaaaattcatgttcaaatacaattctcacatgttaaaaatgatccaaactggt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49511232 |
tgggttaatatattagatgtagatcatcatccaatacaaggcggttccaaaattcatgttcaaatacaattctcacatgttaaaaatgatccaaactggt |
49511133 |
T |
|
| Q |
203 |
cacaaggaataaagagtccaggatatcaaggagttc |
238 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |
|
|
| T |
49511132 |
cacaaggactaaagagtccaggatatcaaggagttc |
49511097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 5 - 59
Target Start/End: Complemental strand, 49522280 - 49522226
Alignment:
| Q |
5 |
tattcactgtcaaacaagataaccccattggagcaactctaattggaagagctta |
59 |
Q |
| |
|
|||||||||||||| | ||||| || ||||| ||||||||||| ||||||||||| |
|
|
| T |
49522280 |
tattcactgtcaaagatgataatccgattggtgcaactctaataggaagagctta |
49522226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University