View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3371_low_13 (Length: 366)
Name: NF3371_low_13
Description: NF3371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3371_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 26 - 355
Target Start/End: Original strand, 6227081 - 6227410
Alignment:
| Q |
26 |
tatctacaggtttcggcaatgagcttgagtttccattaccttgtccaacacgttgttgtcatactgtttatcatccagttattcgtgttgattatacacc |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6227081 |
tatctacaggtttcggcaatgagcttgagtttccattaccttgtccaacacgttgttgtcatactgtttatcatccagttattcgtgttgattatacacc |
6227180 |
T |
|
| Q |
126 |
tccgattgcgggtatgtttgtaccctcatacctgaaggcttttgtgaaagagatgactactctgtcctccgatgacaagaacaagaattcttttctggta |
225 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6227181 |
tccgattgcgggtatgtttgtacctccatacctgaaggcttttgtgaaagagatgactactctgtcctccgatgacaagaacaagaattcttttctggta |
6227280 |
T |
|
| Q |
226 |
gtcgtaggcaacctcccgcccgagacaaggaaccatgatttgcttcaacttttccagccttttggtcatgtcatcggtgccgatgttgctattgctcatc |
325 |
Q |
| |
|
|| | |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | |
|
|
| T |
6227281 |
gtaggaggcaacctcccacccgagacaaggaaccatgatttgcttcaacttttccagccttttggtcatgtcatcggtgccgatattgctattgctcaac |
6227380 |
T |
|
| Q |
326 |
acactggccttagtggccgttttgcctttg |
355 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
6227381 |
acactggccttagtggccgttttgcctttg |
6227410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University