View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3371_low_24 (Length: 246)
Name: NF3371_low_24
Description: NF3371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3371_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 25537673 - 25537906
Alignment:
| Q |
1 |
taaagacagacacattacaacatttgactatgtaactagccctgaaattttaggaaaaaccctcttatttctaagaccttaca---tatgaaaataatct |
97 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
25537673 |
taaagaccgacacattacaacatttgactatgtaactagccctgaaattttaggaaaaaccctcttatttctaagaccttacacaatatgaaaagaatct |
25537772 |
T |
 |
| Q |
98 |
taggaaaaaccttccaaacactcttaaaaacttcagcgaaaatatcacgaatcatagctaggttcggcaactctcggctttcatccaacaaaccttcacc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25537773 |
taggaaaaaccttccaaacactcttaaaaacttcagcgaaaatatcacgaatcatagctaggttcggcaactctcggctttcatccaacaaaccttcacc |
25537872 |
T |
 |
| Q |
198 |
gcacagtcccttgatgacaacctcatagcaagtg |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
25537873 |
gcacagtcccttgatgacaacctcatagcaagtg |
25537906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 180 - 227
Target Start/End: Complemental strand, 43224470 - 43224423
Alignment:
| Q |
180 |
atccaacaaaccttcaccgcacagtcccttgatgacaacctcatagca |
227 |
Q |
| |
|
|||||||||||||||| | |||||||||||||| |||||||||||||| |
|
|
| T |
43224470 |
atccaacaaaccttcagcacacagtcccttgatcacaacctcatagca |
43224423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University