View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3371_low_30 (Length: 228)
Name: NF3371_low_30
Description: NF3371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3371_low_30 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 44085973 - 44085746
Alignment:
| Q |
1 |
gtttcaagattttttgctggaactcaagaaaaatgtgttggttgcaagaaaacagtgtacccaattgaaaaggtatgttaaataacttaactttattctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| ||||||| |
|
|
| T |
44085973 |
gtttcaagattttttgctggaactcaagaaaaatgtgttggttgcaagaaaacagtgtacccaattgaaaaggtatattatataacttaactatattctt |
44085874 |
T |
|
| Q |
101 |
tagtaaactttactgattgggaaatgtccctttaaaagtaattttgcctctaaaatgagtaaggttgaatctatccttaaatgttaacatcatggtacac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44085873 |
tagtaaactttactgattgggaaatgtccctttaaaagtaattttgcctctaaaatgagtaaggttgaatctatccttaaatgttaacatcatggtacac |
44085774 |
T |
|
| Q |
201 |
tttaaatgatattaatggtgaatatatt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
44085773 |
tttaaatgatattaatggtgaatatatt |
44085746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University