View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3372_high_15 (Length: 262)
Name: NF3372_high_15
Description: NF3372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3372_high_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 4166680 - 4166921
Alignment:
| Q |
1 |
tggagggaatatcatggcagcaatgactggaaggggatgttggatcccttggacgacaacctccggcgagaggttgttagatatggcgatttggttcaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4166680 |
tggagggaatatcatggcagcaatgactggaaggggatgttggatcccttggatgacaacctccggcgagaggttgttagatatggcgatttggttcaag |
4166779 |
T |
|
| Q |
101 |
ctgcttatcaagcttttcacgctgatcctgccatgtcaacaactgaagcaccccatcatcaacaggtatcgttgccggagagatcttataaagtaaccaa |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4166780 |
ctgcttatcaagcttttcatgctgatcctgccatgtcaacaactgaagcaccccatcaccaacaggtgtcgttgccggagagatcttataaagtaaccaa |
4166879 |
T |
|
| Q |
201 |
gagtctgtatgccacatcatcaattggattacctaaatgggt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4166880 |
gagtctgtatgccacatcatcaattggattacctaaatgggt |
4166921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 187 - 250
Target Start/End: Complemental strand, 41314844 - 41314780
Alignment:
| Q |
187 |
tataaagtaaccaagagtctgtatgccacatcatcaattggattacctaaatggg-tgatgatgt |
250 |
Q |
| |
|
||||||||||| || ||| | |||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
41314844 |
tataaagtaactaaaagtttatatgccacatcatcaattggtttacctaaatgggttgatgatgt |
41314780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University