View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3372_high_18 (Length: 250)
Name: NF3372_high_18
Description: NF3372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3372_high_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 48 - 176
Target Start/End: Original strand, 10929783 - 10929911
Alignment:
| Q |
48 |
tttcttctcctatacattacagacaaattttcactttcagctttcatttcaaatatctaatgtcagctcatcccataaaccattaaacaaataaaacgac |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10929783 |
tttcttctcctatacattacagacaaattttcactttcagctttcatttcaaatatctaatgtcagctcatcccataaactattaaacaaataaaacgac |
10929882 |
T |
 |
| Q |
148 |
tattccaactcaagtacaactaaaaatac |
176 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10929883 |
tattccaactcaagtacaactaaaaatac |
10929911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University