View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3372_low_12 (Length: 350)
Name: NF3372_low_12
Description: NF3372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3372_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 324; Significance: 0; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 1 - 340
Target Start/End: Complemental strand, 28179774 - 28179435
Alignment:
| Q |
1 |
acaacttttgtaacacattttcatatcacatagcattatcattccctttccttttattttatgcagggagagattttaaagcttcatatgtcattttctg |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28179774 |
acaatttttgtaacacattttcatatcacataccattatcattccctttccttttattttatgcagggagagattttaaagcttcatatgtcattttctg |
28179675 |
T |
 |
| Q |
101 |
gtcacctttagaccaaaaagataccagcttgaacataaaacatgtctcgatcgcatcattttcatgaactacttcaatcatccatcgtcttcgcaatcca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28179674 |
ctcacctttagaccaaaaagataccagcttgaacataaaacatgtctcgatcgcatcattttcatgaacgacttcaatcatccatcgtcttcgcaatcca |
28179575 |
T |
 |
| Q |
201 |
ataactttctctttttacaaggatcggtgaattgaatatccgtcatgctactttacggctttaatacatggattccaaattctataggtgataccattat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28179574 |
ataactttctctttttacaaggatcggtgaattgaatatccgtcatgctactttacggctttaatacatggattccaaattctataggtgataccattat |
28179475 |
T |
 |
| Q |
301 |
caaagacacacacatgtaatctccacattgatccattcat |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28179474 |
caaagacacacacatgtaatctccacattgatccattcat |
28179435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 119 - 279
Target Start/End: Complemental strand, 28155085 - 28154929
Alignment:
| Q |
119 |
agataccagcttgaacataaaacatgtctcgatcgcatcattttcatgaactacttcaatcatccatcgtcttcgcaatccaataactttctctttttac |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
28155085 |
agataccagcttgaacataaaacatgtctcgatagcatcatgctcatgaactactgcaatcatc----gtcttcgcaatccaataattttctctttttac |
28154990 |
T |
 |
| Q |
219 |
aaggatcggtgaattgaatatccgtcatgctactttacggctttaatacatggattccaaa |
279 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| | |||||||||||||||||||||| |
|
|
| T |
28154989 |
aaggatcggtgaattgaatatccgccatgctacttttctgctttaatacatggattccaaa |
28154929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 43 - 117
Target Start/End: Complemental strand, 28155941 - 28155864
Alignment:
| Q |
43 |
tccctttccttttatttt----atgcagggagagattttaaagcttcatatgtcattttctggtcacctttagaccaaa |
117 |
Q |
| |
|
||||||||||||| |||| |||||| | |||||||||||||||| ||||||| |||||| |||||||||||||||| |
|
|
| T |
28155941 |
tccctttccttttgttttgtcgatgcagagtgagattttaaagcttcgtatgtca-tttctgctcacctttagaccaaa |
28155864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University