View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3372_low_27 (Length: 252)
Name: NF3372_low_27
Description: NF3372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3372_low_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 92; Significance: 9e-45; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 142 - 245
Target Start/End: Complemental strand, 25539627 - 25539524
Alignment:
| Q |
142 |
atacagtgacccttcacacctctcaggttcgattgcattcagccattgcaatgagtggtaatctgtcgtctggtaaatgtattccttctgataggccttt |
241 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
25539627 |
atacagcgacccttcacacctctcaggttcgattgcattcaaccattgcaatgagtggtaatctgtcgtctggtaaatgtattccttttgataggccttt |
25539528 |
T |
 |
| Q |
242 |
gctt |
245 |
Q |
| |
|
|||| |
|
|
| T |
25539527 |
gctt |
25539524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 41 - 113
Target Start/End: Complemental strand, 25539735 - 25539663
Alignment:
| Q |
41 |
taatagtcaatttaaaataagtttacaattgaaatatgagatcgacaagatgggaaatctgattataaaagaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
25539735 |
taatagtcaatttaaaataagtttacaattgaaatatgagatcgacaagatgggaaatttgattataaaagaa |
25539663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 146 - 241
Target Start/End: Complemental strand, 1863159 - 1863064
Alignment:
| Q |
146 |
agtgacccttcacacctctcaggttcgattgcattcagccattgcaatgagtggtaatctgtcgtctggtaaatgtattccttctgataggccttt |
241 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |||||||||||||||| |
|
|
| T |
1863159 |
agtgacccttcacgcctctcaggttcgattgcattcagccattgcaatgagtggtaatctgtcgtctggaaaatttattgcttctgataggccttt |
1863064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 154 - 244
Target Start/End: Original strand, 20588892 - 20588982
Alignment:
| Q |
154 |
ttcacacctctcaggttcgattgcattcagccattgcaatgagtggtaatctgtcgtctggtaaatgtattccttctgataggcctttgct |
244 |
Q |
| |
|
||||| |||||||||| || | ||||| |||||||||||||||| ||| ||||| |||||||||||| || |||||| |||||||||| |
|
|
| T |
20588892 |
ttcacgcctctcaggtccgccttcattcctccattgcaatgagtgggaatatgtcgaatggtaaatgtatcccgtctgatgggcctttgct |
20588982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University