View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3372_low_28 (Length: 250)

Name: NF3372_low_28
Description: NF3372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3372_low_28
NF3372_low_28
[»] chr5 (1 HSPs)
chr5 (48-176)||(10929783-10929911)


Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 48 - 176
Target Start/End: Original strand, 10929783 - 10929911
Alignment:
48 tttcttctcctatacattacagacaaattttcactttcagctttcatttcaaatatctaatgtcagctcatcccataaaccattaaacaaataaaacgac 147  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
10929783 tttcttctcctatacattacagacaaattttcactttcagctttcatttcaaatatctaatgtcagctcatcccataaactattaaacaaataaaacgac 10929882  T
148 tattccaactcaagtacaactaaaaatac 176  Q
    |||||||||||||||||||||||||||||    
10929883 tattccaactcaagtacaactaaaaatac 10929911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University