View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3372_low_32 (Length: 243)
Name: NF3372_low_32
Description: NF3372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3372_low_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 17 - 227
Target Start/End: Original strand, 39298918 - 39299128
Alignment:
| Q |
17 |
tgccgcagtccaccctgccacggtggccttatccttcaaatcaaccgccactttgcttgcaacttccgcagcagtcttccctgtctctacagtaacatcc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39298918 |
tgccgcagtccaccctgccacggtggccttatccttcaaatcaaccgccactttgcttgcaacttccgcagcagtcttccctgtctctacagtaacatcc |
39299017 |
T |
|
| Q |
117 |
tttgcctgaacaactgcagacttggctttctccgccacaggggtagcatattctgttgcagtttttgcagcgcttgaaacagtgtcttttgttgcttcat |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39299018 |
tttgcctgaacaactgcagacttggctttctccgccacaggggtaacatattctgttgcagtttttgcagcgcttgaaacagtgtcttttgttgcttcat |
39299117 |
T |
|
| Q |
217 |
aaccttgttgt |
227 |
Q |
| |
|
||||||||||| |
|
|
| T |
39299118 |
aaccttgttgt |
39299128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University