View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3372_low_39 (Length: 220)
Name: NF3372_low_39
Description: NF3372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3372_low_39 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 21 - 206
Target Start/End: Complemental strand, 39089119 - 39088934
Alignment:
| Q |
21 |
caagtagggacaccattaacctgattataagaacacatcacactagccacattaccttccttcacacacatcctaaatggcacattgaacgtgtcttcca |
120 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39089119 |
caagtagggacaccattaacctgattgtaagaacacatcacactagccacattaccttccttcacacacatcctaaatggcacattgaacgtgtcttcca |
39089020 |
T |
 |
| Q |
121 |
tgtcctgtttgctaacctgtgcatgtagacatgagtatgagtatattcaaagttagaaaagaaacacaaaaatgacccacatttct |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39089019 |
tgtcctgtttgctaacctgtgcatgtagacatgagtatgagtatattcaaagttagaaaagaaacacaagaatgacccacatttct |
39088934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 24 - 124
Target Start/End: Original strand, 44716542 - 44716642
Alignment:
| Q |
24 |
gtagggacaccattaacctgattataagaacacatcacactagccacattaccttccttcacacacatcctaaatggcacattgaacgtgtcttccatgt |
123 |
Q |
| |
|
|||||||| ||||| || ||||| ||||||||||| |||||||| || || |||||||||||||||||||| ||||| |||| || |||||||| |||| |
|
|
| T |
44716542 |
gtagggaccccatttacttgattgtaagaacacatgacactagctacttttccttccttcacacacatcctgaatggtacatcaaatgtgtcttctatgt |
44716641 |
T |
 |
| Q |
124 |
c |
124 |
Q |
| |
|
| |
|
|
| T |
44716642 |
c |
44716642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University