View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3374_high_11 (Length: 248)
Name: NF3374_high_11
Description: NF3374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3374_high_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 156 - 231
Target Start/End: Complemental strand, 25680475 - 25680400
Alignment:
| Q |
156 |
ataaaatgtgatatgcctaaattgaaggctatgtagatacatccaaatttaagagagaaataaacaagctaattat |
231 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
25680475 |
ataaaatgtgataggcctaaattgaaggccatgtagatacatccaaaattaagagagaaataaacaagctaattat |
25680400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University