View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3374_high_13 (Length: 241)
Name: NF3374_high_13
Description: NF3374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3374_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 27274037 - 27273826
Alignment:
| Q |
1 |
attgtttgtagggttgaaaaacccttccccactagctggcaatggcataatggataacggaccaaagtccggagcatgtgttatacgcaccataaagtgg |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27274037 |
attgtttgtagggttgaaaaactcttccccaatagctggcaatggcataatggataacggaccaaagtccggagcatgtgttatacgcaccataaagtgg |
27273938 |
T |
 |
| Q |
101 |
tgacaaaaagagaaaaaggaaactacaaaggatcgtacaattgtggggatgatgagtcaaagacaatatttctattgattgttgcactggcctaatggct |
200 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27273937 |
tgacaaaaagagaaaaacgaaactacaaaggatcgtataattgtggggatgatgagtcaaagacaatatttctattgattgttgcactggcctaatggct |
27273838 |
T |
 |
| Q |
201 |
tattgcattttg |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
27273837 |
tattgcattttg |
27273826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University