View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3374_high_8 (Length: 261)
Name: NF3374_high_8
Description: NF3374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3374_high_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 53 - 253
Target Start/End: Original strand, 52154761 - 52154961
Alignment:
| Q |
53 |
tttgtccaactcggccacaagaagaaattcagataaagatgatatggaagattcgtcattgccatcgattgtgggcaaaagattacagaattcatttgaa |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52154761 |
tttgtccaactcggccacaagaagaaattcagataaagatgatatggaagattcatcattgccatcgattgtgggcaaaagattacagaattcatttgaa |
52154860 |
T |
|
| Q |
153 |
gagatggaagcggttggatttaagagaagattcttggattgttcttgatgcatgtatttctcatcaagatcttcaacactttgataaatgtttcctatgc |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52154861 |
gagatggaagcggttggatttaagagaagattcttggattgttcttgatgcatgaatttctcatcaagatcttcaacactttgataaatgtttcctatgc |
52154960 |
T |
|
| Q |
253 |
t |
253 |
Q |
| |
|
| |
|
|
| T |
52154961 |
t |
52154961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University