View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3374_low_12 (Length: 243)
Name: NF3374_low_12
Description: NF3374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3374_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 43926796 - 43927011
Alignment:
| Q |
1 |
cacttaaataaatttgtttatgcaagtatactagtaaattacgactatttttataagattacttataaattaagagcgtaaattgagcgttaaatcatga |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43926796 |
cacttaaataaatttgtttatgcaaatatactagtaaattacgactatttttataagattacttataaattaagagc-----------gttaaatcatga |
43926884 |
T |
 |
| Q |
101 |
ggcaaattttagttgaactttcaagttacaccaaagcaaagcaaccaatggcaattatctctaacgtacctttaactctcgagatttaattttgtgaaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43926885 |
ggcaaattttagttgaactttcaagttacaccaaagcaaagcaaccaatggcaattatctctaacgtacctttaactctcgagatttaattttgtgaaag |
43926984 |
T |
 |
| Q |
201 |
gttccaacgtcaataataggatacttg |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
43926985 |
gttccaacgtcaataataggatacttg |
43927011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University