View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3374_low_14 (Length: 240)
Name: NF3374_low_14
Description: NF3374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3374_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 84 - 227
Target Start/End: Complemental strand, 52154599 - 52154456
Alignment:
| Q |
84 |
atacgtaggatctactttgtactatgcctgcccaaatagatgtggtgtagaggtcacatgtgatgaaaaaactatttgttctcggtgcaacatagctatg |
183 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52154599 |
atacataggatctactttgtactatgcctgcccaaatagatgtggtgtagaggtcacatgtgatgaaaaaactatttgttctcggtgcaacatagctatg |
52154500 |
T |
|
| Q |
184 |
aaccgccattcacattttgagcttaagacaaaggatgttgaaga |
227 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
52154499 |
aaccgccgttcacattttgagcttaagacaaaggatgttgaaga |
52154456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University