View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3375_high_31 (Length: 247)
Name: NF3375_high_31
Description: NF3375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3375_high_31 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 21 - 247
Target Start/End: Complemental strand, 11019159 - 11018934
Alignment:
| Q |
21 |
gagagggtcacatgagcgatttcgatttgacaaaacaaagaaagccctacaatgtgttgagttttaaagcacacattgattttcttttgtttttgttgaa |
120 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11019159 |
gagagggtcacatgatcaatttcgatttgacaaaacaaagaaagcc-tacaatgtgttgagttttaaagcacacattgattttcttttgtttttgttgaa |
11019061 |
T |
 |
| Q |
121 |
ccgagattgatcaagtcaccatctcaaatgtgaggacgacaagaattttgagcttctacttgtaaaagctgttatctatcgttatcgaaatttcagacaa |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11019060 |
ccgagattgatcaagtcaccatctcaaatgtgaggacgacaagaattttgagcttctacttgtaaaagctgttatctatcgttatcgaaatttcagacaa |
11018961 |
T |
 |
| Q |
221 |
ttttcaacaataaataaagtagtcgac |
247 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
11018960 |
ttttcaacaataaataaagtagtcgac |
11018934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University