View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3375_high_38 (Length: 239)
Name: NF3375_high_38
Description: NF3375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3375_high_38 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 15 - 226
Target Start/End: Complemental strand, 17894157 - 17893947
Alignment:
| Q |
15 |
aatatcatcactataccatgtaccaaaaggtacacaaagcactatgatgaaaatatgcaagcaaatataaccattgattacatggaccatttgctcatac |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
17894157 |
aatatcatcactataccatgtaccaaaaggtacacaaagcactatgatgaaaatatgcaaacaaatataaccattgattacatggaccatt-gctcatac |
17894059 |
T |
|
| Q |
115 |
ctcgcatgggttagttatgtgcttttgactttttcagttgagagaagttaaacagaaattatctgctgaaaataagtagagggaagggacagaataattg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17894058 |
ctcgcatgggttagttatgtgcttttgactttttcagttgagagaagttaaacagaaattatctgctgaaaataagtagagggaagggacagaataattg |
17893959 |
T |
|
| Q |
215 |
tttttatgacct |
226 |
Q |
| |
|
|||||||||||| |
|
|
| T |
17893958 |
tttttatgacct |
17893947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University