View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3375_high_42 (Length: 236)

Name: NF3375_high_42
Description: NF3375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3375_high_42
NF3375_high_42
[»] chr1 (1 HSPs)
chr1 (145-220)||(39425195-39425267)


Alignment Details
Target: chr1 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 145 - 220
Target Start/End: Original strand, 39425195 - 39425267
Alignment:
145 ataatacaccataaattaaatcatgtacaattaagatttaattgatagtaacatttttcatttaagaagtatgatg 220  Q
    |||||||||||||||||||||||||||||||||||||||||||||   ||||||||||||||||||||||||||||    
39425195 ataatacaccataaattaaatcatgtacaattaagatttaattga---taacatttttcatttaagaagtatgatg 39425267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University