View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3375_high_47 (Length: 224)
Name: NF3375_high_47
Description: NF3375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3375_high_47 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 18 - 208
Target Start/End: Original strand, 45341551 - 45341741
Alignment:
| Q |
18 |
agatacataataaagagggaaaataacataaataggtgtggagagaaaggtggaacaccaacaaattttgtgaggagtgaggacacagcaaaaatgcagc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45341551 |
agatacataataaagagggaaaataacataaataggtgtggagagaaaggtggaacaccaacaaattttgtgaggagtgaggacacagcaaaaatgcagc |
45341650 |
T |
 |
| Q |
118 |
taattaaccatggatcgtggatgctgcagaggtcattgcaactccggatcttttacgatcttcagttttgtgctcgtaagagcgatggggg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45341651 |
taattaaccatggatcgtggatgctgcagaggtcattgcaactccggatcttttacgatcttcagttttgtgctcgtaagagcgatggggg |
45341741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University