View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3375_high_6 (Length: 501)
Name: NF3375_high_6
Description: NF3375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3375_high_6 |
 | |
|
| [»] scaffold0194 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0194 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: scaffold0194
Description:
Target: scaffold0194; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 4 - 314
Target Start/End: Original strand, 16207 - 16517
Alignment:
| Q |
4 |
tgttgcaaattataggagcaaagaaatttacctgattcagttgaggaggagggaagagtggaaggcatgacataaccatgattagaagaatcctttttgc |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16207 |
tgttgcaaattataggagcaaagaaatttacctgattcagttgaggaggagggaagagtggaaggcatgacataaccatgattagaagaatcctttttgc |
16306 |
T |
|
| Q |
104 |
tttgtcttctgaagcaccagatggcaactccaatgaagccaagaaatagaattccaccaaacactgcaatagccaatatagcaccagaactaattcctcc |
203 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
16307 |
gttgtcttctgaagcaccagatagcaactccaatgaagccaagaaatagaattccaccaaacacggcaatagccaatatagcaccagaactaattcctcc |
16406 |
T |
|
| Q |
204 |
ggattgagggcttgagttttctgatccgttctgcagtggtggaggaggtggagacaattgaataattgaggagggtgttggaggagatagcctcggtgtt |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
16407 |
agattgagggcttgagttttctgatccgttctgcagtggtggaggaggtggcgacaattgaatgattgaggcgggtgttggaggagatagcctcggtgtt |
16506 |
T |
|
| Q |
304 |
gttgaatttga |
314 |
Q |
| |
|
||||||||||| |
|
|
| T |
16507 |
gttgaatttga |
16517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University