View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3375_low_17 (Length: 329)
Name: NF3375_low_17
Description: NF3375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3375_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 18 - 326
Target Start/End: Original strand, 21886017 - 21886324
Alignment:
| Q |
18 |
gttcttccttcaggtaacatgaaaattcctactaatttcatttacaaatatgatttttactacatgtattcctagtctaatgaatcaaagatttnnnnnn |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
21886017 |
gttcttccttcaggtaacatgaaaattcctactaatttcatttacaaatatgatttttactacaagtattcctagtctaatgaatcaaagatttaaaaat |
21886116 |
T |
|
| Q |
118 |
nnnnnngtttaagtagtttgatcaaagttccaaaataatttgctttggtgattatgaaattcttgtcaaatgcgtnnnnnnnctatgacatggcaaaatt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
21886117 |
aaaaaagtttaagtagtttgatcaaagttccaaaataatttgctttggtgattatgaaattcttgtcaaatgcgtaaaaaa-ctatgacatggcaaaatt |
21886215 |
T |
|
| Q |
218 |
tattttattgaacatctggatatcacaatttaacttcttttgttggctgcgggattggcaattacgaaagatccaaatgccgagtgtgtagcgtcatctg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| || |
|
|
| T |
21886216 |
tattttattgaacatctggatatcacaatttaacttcttttgttggctgcaggattggcaattacgaaagatccaaatgcccagtgtgtagcgtcatgtg |
21886315 |
T |
|
| Q |
318 |
tgctcctcc |
326 |
Q |
| |
|
|||| |||| |
|
|
| T |
21886316 |
tgcttctcc |
21886324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 137 - 189
Target Start/End: Original strand, 21913281 - 21913333
Alignment:
| Q |
137 |
gatcaaagttccaaaataatttgctttggtgattatgaaattcttgtcaaatg |
189 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
21913281 |
gatcaaagttcaaaaataattttctttggtgattatgaaattcctgtcaaatg |
21913333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 238 - 280
Target Start/End: Original strand, 21913344 - 21913386
Alignment:
| Q |
238 |
tatcacaatttaacttcttttgttggctgcgggattggcaatt |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
21913344 |
tatcacaatttaacttcttttgttggctgcaggattggcaatt |
21913386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 50
Target Start/End: Original strand, 21913054 - 21913086
Alignment:
| Q |
18 |
gttcttccttcaggtaacatgaaaattcctact |
50 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
21913054 |
gttcttccttcaggtaacatgaaaattcctact |
21913086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University