View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3375_low_30 (Length: 250)
Name: NF3375_low_30
Description: NF3375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3375_low_30 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 115 - 250
Target Start/End: Complemental strand, 3068613 - 3068478
Alignment:
| Q |
115 |
ctttccttattgttaatcttggtgaataatcaaatgaatttcattaaaccaaaaagagttttggacacataaccctaaattggccagcttgtcgtccaat |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3068613 |
ctttccttattgttaatcttggtgaataatcaaatgaatttcattaaaccaaaaagagtattggacacataaccctaaattggccagcttgtcgtccaat |
3068514 |
T |
 |
| Q |
215 |
tgctaaccttccctaaaattgtgggaaattacaaaa |
250 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3068513 |
tggtaaccttccctaaaattgtgggaaattacaaaa |
3068478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University