View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3375_low_37 (Length: 244)
Name: NF3375_low_37
Description: NF3375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3375_low_37 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 19 - 123
Target Start/End: Original strand, 51843427 - 51843531
Alignment:
| Q |
19 |
aaacatccacctataacttaacataacatatcctcaatcctcaacaaaaatctgtttatagaggatcacacctgtttcgcttgtagatgttactggactt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51843427 |
aaacatccacctataacttaacataacatatcctcaatcctcaacaaaaatctatttatagaggatcacacctgtttcgcttgtagatgttactggactt |
51843526 |
T |
|
| Q |
119 |
ggcaa |
123 |
Q |
| |
|
||||| |
|
|
| T |
51843527 |
ggcaa |
51843531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 197 - 244
Target Start/End: Original strand, 51843605 - 51843652
Alignment:
| Q |
197 |
cacttcattttctactttcttggtcttgttttcggtctagttaggatt |
244 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
51843605 |
cacttcattttcaactttcttggtcttgttttcggtctagttaggatt |
51843652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University