View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3375_low_38 (Length: 242)
Name: NF3375_low_38
Description: NF3375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3375_low_38 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 3068302 - 3068076
Alignment:
| Q |
1 |
aacaataacttctgatttt-atttagaacttgtatctaatcatggagatttatatctttagtctttactatcattcttttacaaatactaatatgtgtta |
99 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3068302 |
aacaataacttctgattttcacttagaacttgtatctgataatggagatttatatctttagtctttactatcattcttttacaaatactagtatgtgtta |
3068203 |
T |
 |
| Q |
100 |
attttaaatcagatgtatgacatttttatgataaaatatcactttacataattatattgacatttgatattaaagttttatttttcaaggaaaaaatata |
199 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
3068202 |
attttaaatcagatctatgacatttttatgataaaatatcactttacataattatattgatttttgctattaaagttttatttttgaaggaaaaaatata |
3068103 |
T |
 |
| Q |
200 |
ttgatcacactttatttatatagaaaa |
226 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
3068102 |
ttgatcacactttatttatatagaaaa |
3068076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 40 - 110
Target Start/End: Original strand, 29183366 - 29183436
Alignment:
| Q |
40 |
catggagatttatatctttagtctttactatcattcttttacaaatactaatatgtgttaattttaaatca |
110 |
Q |
| |
|
|||||||||||| |||||||||| |||||| |||||| | || || ||||||||||| ||||||||||| |
|
|
| T |
29183366 |
catggagatttagttctttagtctatactattgttctttaaaaactattaatatgtgttcattttaaatca |
29183436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University