View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3375_low_40 (Length: 239)

Name: NF3375_low_40
Description: NF3375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3375_low_40
NF3375_low_40
[»] chr1 (1 HSPs)
chr1 (15-226)||(17893947-17894157)


Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 15 - 226
Target Start/End: Complemental strand, 17894157 - 17893947
Alignment:
15 aatatcatcactataccatgtaccaaaaggtacacaaagcactatgatgaaaatatgcaagcaaatataaccattgattacatggaccatttgctcatac 114  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||    
17894157 aatatcatcactataccatgtaccaaaaggtacacaaagcactatgatgaaaatatgcaaacaaatataaccattgattacatggaccatt-gctcatac 17894059  T
115 ctcgcatgggttagttatgtgcttttgactttttcagttgagagaagttaaacagaaattatctgctgaaaataagtagagggaagggacagaataattg 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17894058 ctcgcatgggttagttatgtgcttttgactttttcagttgagagaagttaaacagaaattatctgctgaaaataagtagagggaagggacagaataattg 17893959  T
215 tttttatgacct 226  Q
    ||||||||||||    
17893958 tttttatgacct 17893947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University