View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3375_low_45 (Length: 233)
Name: NF3375_low_45
Description: NF3375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3375_low_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 11 - 216
Target Start/End: Original strand, 50553844 - 50554049
Alignment:
| Q |
11 |
cgaagaatatctgtaacgattactatattaataacaattatagaattcttcagaaaataaaacacataattgttggttcacacatttcatgcgtggttag |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
50553844 |
cgaaaaatatctgtaacgattactatattaataacaattatagaattctttagaaaataaaacacataattgttggttcacacatttcatgtgtggttaa |
50553943 |
T |
 |
| Q |
111 |
cccagttcaatgcatatatcatgattggataactcaccaacctacaactgaaatttatttaccatgagtttgaaaataataaaccacaatttcaggtgtt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
50553944 |
cccagttcaatgcatatatcatgattggataactcaccaacctacaactgaaatttatttgccacgagtttgaaaataataaaccacaatttcaggtgtt |
50554043 |
T |
 |
| Q |
211 |
tcaact |
216 |
Q |
| |
|
|||||| |
|
|
| T |
50554044 |
tcaact |
50554049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University