View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3375_low_47 (Length: 228)
Name: NF3375_low_47
Description: NF3375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3375_low_47 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 3 - 216
Target Start/End: Complemental strand, 38950272 - 38950059
Alignment:
| Q |
3 |
tacattggcgatgtagattcaatactcgtagttcttattgtatagcaagtgtgagttaaaagttcgatgttgagtattgagatccataaactcaatatct |
102 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38950272 |
tacattggcggtgtagattcaatactcatagttcttattgtatagcaaatgtgagttaaaagttcgatgttgagtattgagatccataaactcaatatct |
38950173 |
T |
|
| Q |
103 |
taaagttatgcattaagatatgatgtccaacttaattgtatgattgtttttgatcaaatgtggttgatctctcagactctccacatacccccaacaattt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
38950172 |
taaagttatgcattaagatatgatgtccaactcaattgtataattgtttttgatcaaatgtggttgatctctcatactccccacatacccccaacaattt |
38950073 |
T |
|
| Q |
203 |
ctacctatgctact |
216 |
Q |
| |
|
|||| ||||||||| |
|
|
| T |
38950072 |
ctacgtatgctact |
38950059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University