View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3375_low_49 (Length: 224)

Name: NF3375_low_49
Description: NF3375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3375_low_49
NF3375_low_49
[»] chr8 (1 HSPs)
chr8 (18-208)||(45341551-45341741)


Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 18 - 208
Target Start/End: Original strand, 45341551 - 45341741
Alignment:
18 agatacataataaagagggaaaataacataaataggtgtggagagaaaggtggaacaccaacaaattttgtgaggagtgaggacacagcaaaaatgcagc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45341551 agatacataataaagagggaaaataacataaataggtgtggagagaaaggtggaacaccaacaaattttgtgaggagtgaggacacagcaaaaatgcagc 45341650  T
118 taattaaccatggatcgtggatgctgcagaggtcattgcaactccggatcttttacgatcttcagttttgtgctcgtaagagcgatggggg 208  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45341651 taattaaccatggatcgtggatgctgcagaggtcattgcaactccggatcttttacgatcttcagttttgtgctcgtaagagcgatggggg 45341741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University