View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3375_low_50 (Length: 217)
Name: NF3375_low_50
Description: NF3375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3375_low_50 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 72; Significance: 6e-33; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 28223032 - 28222949
Alignment:
| Q |
18 |
gtttttgtgctagatatctgatttatgagttttgcttgaattgatgaatttatgaagatgattctataaatttgaagaaggata |
101 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28223032 |
gtttttgtactagatatctgatttatgagttttgcttgaattgataaatttatgaagatgattctataagtttgaagaaggata |
28222949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 18 - 97
Target Start/End: Original strand, 9071613 - 9071692
Alignment:
| Q |
18 |
gtttttgtgctagatatctgatttatgagttttgcttgaattgatgaatttatgaagatgattctataaatttgaagaag |
97 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9071613 |
gtttttgtgttagatatctgatttacgagttttgcttgaattgatgaatttatgaagatgattctataagtttgaagaag |
9071692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 67; Significance: 6e-30; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 18 - 88
Target Start/End: Complemental strand, 40320814 - 40320744
Alignment:
| Q |
18 |
gtttttgtgctagatatctgatttatgagttttgcttgaattgatgaatttatgaagatgattctataaat |
88 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40320814 |
gtttttgtgttagatatctgatttatgagttttgcttgaattgatgaatttatgaagatgattctataaat |
40320744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 19 - 97
Target Start/End: Original strand, 45519129 - 45519207
Alignment:
| Q |
19 |
tttttgtgctagatatctgatttatgagttttgcttgaattgatgaatttatgaagatgattctataaatttgaagaag |
97 |
Q |
| |
|
|||||||| || | ||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
45519129 |
tttttgtgttaaacatctgatttatgagttttgcttgaattgatgaatttacgaagatgattctataagtttgaagaag |
45519207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 28 - 97
Target Start/End: Complemental strand, 6627409 - 6627340
Alignment:
| Q |
28 |
tagatatctgatttatgagttttgcttgaattgatgaatttatgaagatgattctataaatttgaagaag |
97 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| | ||||||||||||||||| ||| ||||||||| |
|
|
| T |
6627409 |
tagatacctgatttatgagttttgcttgaattgataattttatgaagatgattctgtaagcttgaagaag |
6627340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University