View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3376-Insertion-17 (Length: 188)
Name: NF3376-Insertion-17
Description: NF3376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3376-Insertion-17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 7 - 177
Target Start/End: Complemental strand, 1840984 - 1840814
Alignment:
| Q |
7 |
aacaagttgtgatggtgattgtaagaacaatatccttccagagattgaagcaaaagtcattggaaaggaagtgcttattgaaatccattgtgagaaacaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1840984 |
aacaagttgtgatggtgattgtaagaacaatatccttccagagattgaagcaaaagtcattggaaaggaagtgcttattgaaatccattgtgagaaacaa |
1840885 |
T |
|
| Q |
107 |
aatggaattgaactcaaattattgaaccatattgaaaatcttcaactctttgtcactggtagcactgtctt |
177 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1840884 |
aatggaattgaactcaaattatttaaccatattgaaaatcttcaactctttgtcactggtagcagtgtctt |
1840814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 7 - 177
Target Start/End: Complemental strand, 1820729 - 1820559
Alignment:
| Q |
7 |
aacaagttgtgatggtgattgtaagaacaatatccttccagagattgaagcaaaagtcattggaaaggaagtgcttattgaaatccattgtgagaaacaa |
106 |
Q |
| |
|
||||||||||| || ||||||||| | ||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1820729 |
aacaagttgtggtgatgattgtaaccatcatatccttccagatattgaagcaagagtcattggaaaggaagtgcttattgaaatccattgtgagaaacaa |
1820630 |
T |
|
| Q |
107 |
aatggaattgaactcaaattattgaaccatattgaaaatcttcaactctttgtcactggtagcactgtctt |
177 |
Q |
| |
|
||||||||||| ||||||||| | ||||| |||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1820629 |
aatggaattgagctcaaattacttaaccacattgaaaatcttcaactctttgtcactggtagcagtgtctt |
1820559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University