View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3376-Insertion-18 (Length: 181)
Name: NF3376-Insertion-18
Description: NF3376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3376-Insertion-18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 9e-75; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 9e-75
Query Start/End: Original strand, 8 - 177
Target Start/End: Original strand, 3745040 - 3745209
Alignment:
| Q |
8 |
tgcaggagtagcagccattgccttggcatctctaacacaggatctagttggagcattgtgtgatgatgtcttctccacattgtcatctgaaagatccatc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
3745040 |
tgcaggagtagcagccattgccttggcatctctaacataggatctagttggagcattgtgtgatgatgtcttctccatattgtcatctgaaaggtccatc |
3745139 |
T |
 |
| Q |
108 |
atctggtgcaaagcgtgtagcactggagcatctaaacccatcaacctgaaatccattctcacactttttc |
177 |
Q |
| |
|
|| ||||| | ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3745140 |
atttggtgaagagcgtgtagcactggagcatccaaacccatcaacctgaaatccattctcacactttttc |
3745209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University