View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3376-Insertion-19 (Length: 146)
Name: NF3376-Insertion-19
Description: NF3376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3376-Insertion-19 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 5e-54; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 5e-54
Query Start/End: Original strand, 8 - 146
Target Start/End: Original strand, 2056442 - 2056571
Alignment:
| Q |
8 |
accggaacagtagccccctttaggctatggggctaaaaggcctatcaaccatcgcatgtggcttatgtccttattgtagtttcaatgttttgacctcaaa |
107 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2056442 |
accggaacagtagccccctttaggcta---------aaggcctatcaaccatcgcatgtggcttatgtccttattgtagtttcaatgttttgacctcaaa |
2056532 |
T |
|
| Q |
108 |
tcttagacaccgcttttctaaggtattgtccgcattgag |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2056533 |
tcttagacaccgcttttctaaggtattgtccgcattgag |
2056571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University