View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3376-Insertion-20 (Length: 104)
Name: NF3376-Insertion-20
Description: NF3376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3376-Insertion-20 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 69; Significance: 2e-31; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 69; E-Value: 2e-31
Query Start/End: Original strand, 36 - 104
Target Start/End: Original strand, 1145555 - 1145623
Alignment:
| Q |
36 |
ggtcttttatgatgcaatgaaagggcacaattgggaaatcataaaaagatggaactttggcctgtttgt |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1145555 |
ggtcttttatgatgcaatgaaagggcacaattgggaaatcataaaaagatggaactttggcctgtttgt |
1145623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000003; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 37 - 74
Target Start/End: Complemental strand, 27801597 - 27801560
Alignment:
| Q |
37 |
gtcttttatgatgcaatgaaagggcacaattgggaaat |
74 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
27801597 |
gtcttttatgatgcaatgaaagggtacaattggaaaat |
27801560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 37 - 74
Target Start/End: Original strand, 30725023 - 30725060
Alignment:
| Q |
37 |
gtcttttatgatgcaatgaaagggcacaattgggaaat |
74 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
30725023 |
gtcttttatgatgcaatgaaagggtacaattggaaaat |
30725060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University