View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3376_high_105 (Length: 223)
Name: NF3376_high_105
Description: NF3376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3376_high_105 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 14 - 206
Target Start/End: Complemental strand, 17775838 - 17775647
Alignment:
| Q |
14 |
aatatgcttgaggggaccgctttgcccttttaggaacattatgtctaaatttttaccttgaaaatgcaatttagctttcnnnnnnnactactatcaatgt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
17775838 |
aatatgcttgaggggaccgctttgcccttttaggaacattatgtctaaatgtttaccttgaaaatgcaatttagctat-tttttttactactatcaatgt |
17775740 |
T |
|
| Q |
114 |
gtcaaacatgagagttaggtaaaaacttattttcaatgtggtgttacattgtatttgccacttttttgtttgagttttcttcaccgagtagaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17775739 |
gtcaaacatgagagttaggtaaaaacttattttcaatgaggtgttacattgtatttgccacttttttgtttgagttttcttcaccgagtagaa |
17775647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University