View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3376_high_96 (Length: 239)
Name: NF3376_high_96
Description: NF3376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3376_high_96 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 15 - 223
Target Start/End: Original strand, 24771027 - 24771235
Alignment:
| Q |
15 |
catagggaatccttatatcgttattataagagaaaaaagccaagaacatatcaaatcaaagatgtccaacgttcatatttaagcaaa-----attattgg |
109 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24771027 |
catagggaatccttgt-tcgttattataagagaaaaaagccaagaacat--caaatcaaagatgtccaacgttcatatttaagcaaagcaaaattattgg |
24771123 |
T |
|
| Q |
110 |
attgaaaccccatcttccctgttccacacatgacacaaccatcattattgtttcattcttataagtcaagataaacattatatctagaccatagaaaagt |
209 |
Q |
| |
|
|||||||||||||| || |||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24771124 |
attgaaaccccatc--ccatgttcctcatatgacacaaccatcattattgtttcattcttataagtcaagataaacattatatctagaccatagaaaagt |
24771221 |
T |
|
| Q |
210 |
tagaaggaccaaca |
223 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
24771222 |
tagaaggaccaaca |
24771235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 45 - 116
Target Start/End: Complemental strand, 21659105 - 21659036
Alignment:
| Q |
45 |
agaaaaaagccaagaacatatcaaatcaaagatgtccaacgttcatatttaagcaaaattattggattgaaa |
116 |
Q |
| |
|
||||||||||||||||||| |||||||| | |||||| |||||||||| ||||||||||| | ||||||| |
|
|
| T |
21659105 |
agaaaaaagccaagaacat--caaatcaagcaagtccaatgttcatatttgagcaaaattatcgaattgaaa |
21659036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University