View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3376_low_100 (Length: 242)
Name: NF3376_low_100
Description: NF3376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3376_low_100 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 21 - 242
Target Start/End: Complemental strand, 35355881 - 35355660
Alignment:
| Q |
21 |
tattcacaatcacatggggttatactattacgagaaattcaattccttgttcctacagcagtgtcttgtcacttcagcaaaatatagtaaattgctcatt |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35355881 |
tattcacaatcacatggggttatactattacgagaaattcaattctctgttcctacagcagtgtcttgtcacttcagcaaaatatagtaaattgctcatt |
35355782 |
T |
|
| Q |
121 |
actccacaatgaaaatttaaagactcttgttgcgtgttatgagtgaatatctgttattcatgtcaacatgcttaaaactggaaactgaaatcaacttgtc |
220 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35355781 |
actccacaatgaaaatttagagactcttgttgcgtgttatgagtgaatatctgttattcatgtcaacatgcttaaaactggaaactgaaatcaacttgtc |
35355682 |
T |
|
| Q |
221 |
ataaaaactatcacccttacct |
242 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
35355681 |
ataaaaactatcacccttacct |
35355660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University