View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3376_low_102 (Length: 241)
Name: NF3376_low_102
Description: NF3376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3376_low_102 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
| [»] scaffold0198 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 17 - 241
Target Start/End: Complemental strand, 45744477 - 45744253
Alignment:
| Q |
17 |
cactgggagtatgatgagagtattgttcaccaactctatcgtccgttgctcatttccggttttggatttggcgctcatagatggatcgccaccctccaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45744477 |
cactgggagtatgatgagagtattgttcaccaactctatcgtccgttgctcatttccggttttggatttggcgctcatagatggatcgccaccctccaaa |
45744378 |
T |
|
| Q |
117 |
ggcagtgtgaaggcttggctatcctcatgtcctcttccatctcaaatgatgatcacaccggtaaaacaaatcacatgcatgaatttaaatcgttatattt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45744377 |
ggcagtgtgaaggcttggctatcctcatgtcctcttccatctcaaatgatgatcacaccggtaaaacaaatcacatgcatgaatttaaatcgttatattt |
45744278 |
T |
|
| Q |
217 |
tctaatcacttgttaactactaatt |
241 |
Q |
| |
|
|||||||| |||||||||||||||| |
|
|
| T |
45744277 |
tctaatcatttgttaactactaatt |
45744253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0198 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0198
Description:
Target: scaffold0198; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 26 - 126
Target Start/End: Complemental strand, 7697 - 7597
Alignment:
| Q |
26 |
tatgatgagagtattgttcaccaactctatcgtccgttgctcatttccggttttggatttggcgctcatagatggatcgccaccctccaaaggcagtgtg |
125 |
Q |
| |
|
|||||||||||| |||| |||||| ||||||||| ||| | | |||||| | | |||||| |||||||||||| | || || ||||| |||||||||| |
|
|
| T |
7697 |
tatgatgagagtgttgtccaccaagcctatcgtccattggttaattccggcatggcatttggtgctcatagatgggttgcaactctccagaggcagtgtg |
7598 |
T |
|
| Q |
126 |
a |
126 |
Q |
| |
|
| |
|
|
| T |
7597 |
a |
7597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University