View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3376_low_122 (Length: 205)
Name: NF3376_low_122
Description: NF3376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3376_low_122 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 24 - 187
Target Start/End: Original strand, 8807288 - 8807451
Alignment:
| Q |
24 |
ggaaggttaactgtttcacaatctgctttacaaagtgaagaatcttcacaatcatacagaccaacaacattatcaactgatacaccaaagtagtttcttc |
123 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8807288 |
ggaagattaactgtttcacaatctgctttacaaagtgaagaatcttcacaatcatacagaccaacaacattatcaactgatacaccaaagtagtttcttc |
8807387 |
T |
 |
| Q |
124 |
catcaaaactcctctcaccaaatgaattcaaatcgttgtactgtcgacacgatgaggttcctgg |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8807388 |
catcaaaactcctctcaccaaatgaattcaaatcgttgtactgtcgacacgatgaggttcctgg |
8807451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 24 - 172
Target Start/End: Original strand, 22923687 - 22923837
Alignment:
| Q |
24 |
ggaaggttaactgtttcacaatctgctttacaaagtgaagaatcttcacaatcatacagaccaacaacattatcaactgatacaccaaa--gtagtttct |
121 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||| ||||||||||| | ||| |||||| |||||||||| | |||||||| | ||| | |
|
|
| T |
22923687 |
ggaaggttaactgtttcgcaatttgctttacaaagtgaagaaccttcacaatcacagagagcaacaaaattatcaactaagacaccaaattgattttttt |
22923786 |
T |
 |
| Q |
122 |
tccatcaaaactcctctcaccaaatgaattcaaatcgttgtactgtcgaca |
172 |
Q |
| |
|
| |||||||||||||||| ||||| |||||||||||||||| ||||||| |
|
|
| T |
22923787 |
ttcatcaaaactcctctcttcaaataaattcaaatcgttgtatcgtcgaca |
22923837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University