View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3376_low_36 (Length: 403)
Name: NF3376_low_36
Description: NF3376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3376_low_36 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 295; Significance: 1e-165; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 295; E-Value: 1e-165
Query Start/End: Original strand, 1 - 385
Target Start/End: Original strand, 39281378 - 39281765
Alignment:
| Q |
1 |
ctcgttaaaaggccaatttggtgttttaaaactcctgccataagagattcactttataattctcattgatttgaattgtcagata--gtaattcttattc |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| |||| |||||||| |||| |
|
|
| T |
39281378 |
ctcgttaaaaggccaatttggtgttttaaaactcctgccataagagattcactgtataattctcgttgatttgaattgtctgatatagtaattctgattc |
39281477 |
T |
|
| Q |
99 |
tgagcaatttactattctcatgggaaattggggcttttggctagccgctattatccgccacgtttcatccataggatgcattgccatatttatgtgttag |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
39281478 |
tgagcaatttactattctcatgggaaattggggcttttggctagccgctattatccgccacgtttcatccataggatgcattgccatatttatgtggcag |
39281577 |
T |
|
| Q |
199 |
atttttggctttccaccatccatcatcaataatcttcacatagcggtaagtggaaatttcactgtagatacatcacttttgaaggatttcattcttgcca |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
39281578 |
atttttggctttccaccatccatcatcaataatcttcacatagcggtaagtggaaattttgctgtagatacatcacttttgaaggatttcgtttttgcca |
39281677 |
T |
|
| Q |
299 |
tacataactgcacgttgcaagagctgtggcgtcgaattcttgtgttaa-nnnnnnnnnnaaaaccttaccaaatttttgtgtcagatg |
385 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39281678 |
tacataactgcacgttgcaagagctgtggcgtcgaactcttgtgttaatttttttttttaaaaccttaccaaatttttgtgtcagatg |
39281765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 103 - 224
Target Start/End: Complemental strand, 17348648 - 17348529
Alignment:
| Q |
103 |
caatttactattctcatgggaaattggggcttttggctagccgctattatccgccacgtttcatccataggatgcattgccatatttatgtgttagattt |
202 |
Q |
| |
|
||||||||||||||||||| |||| || ||||| |||||| | || ||||||||| ||||||||| ||| ||||||||||||||| |||| || |||| |
|
|
| T |
17348648 |
caatttactattctcatggcaaatcaggactttta-ctagcctccataatccgccacatttcatccaaagggtgcattgccatatttgtgtg-taaattt |
17348551 |
T |
|
| Q |
203 |
ttggctttccaccatccatcat |
224 |
Q |
| |
|
|| ||| ||||||||||||||| |
|
|
| T |
17348550 |
ttagctatccaccatccatcat |
17348529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University